|
BioResource International Inc
lentiviral vectors for tetracycline-inducible short hairpin rna expression Lentiviral Vectors For Tetracycline Inducible Short Hairpin Rna Expression, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/lentiviral+vectors+for+tetracycline+inducible+short+hairpin+rna+expression/pmc08114557-47-10-20 Average 90 stars, based on 1 article reviews
lentiviral vectors for tetracycline-inducible short hairpin rna expression - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
BioResource International Inc
lentiviral vectors for tetracycline (tet)-inducible short hairpin rna (shrna) expression ![]() Lentiviral Vectors For Tetracycline (Tet) Inducible Short Hairpin Rna (Shrna) Expression, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/lentiviral+vectors+for+tetracycline++tet++inducible+short+hairpin+rna++shrna++expression/pmc06436657-94-11-23 Average 90 stars, based on 1 article reviews
lentiviral vectors for tetracycline (tet)-inducible short hairpin rna (shrna) expression - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
lentiviral vectors encoding guide rna targeting human cd74 ![]() Lentiviral Vectors Encoding Guide Rna Targeting Human Cd74, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/lentiviral+vectors+encoding+guide+rna+targeting+human+cd74/10__1158_slash_0008___5472__can___20___2811-98-12-14 Average 90 stars, based on 1 article reviews
lentiviral vectors encoding guide rna targeting human cd74 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
lentiviral vectors expressing a short hairpin rna against vdr ![]() Lentiviral Vectors Expressing A Short Hairpin Rna Against Vdr, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/lentiviral+vectors+expressing+a+short+hairpin+rna+against+vdr/pm27561793-68-0-16 Average 90 stars, based on 1 article reviews
lentiviral vectors expressing a short hairpin rna against vdr - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
lentiviral vector expressing short hairpin rna against panx3 (shpanx3, ggcaggcagagcaacttagtaagagattaataaggatatga) and its negative control (shnc) ![]() Lentiviral Vector Expressing Short Hairpin Rna Against Panx3 (Shpanx3, Ggcaggcagagcaacttagtaagagattaataaggatatga) And Its Negative Control (Shnc), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/lentiviral+vector+expressing+short+hairpin+rna+against+panx3++shpanx3++ggcaggcagagcaacttagtaagagattaataaggatatga++and+its+negative+control++shnc+/pm37021698-54-12-18 Average 90 stars, based on 1 article reviews
lentiviral vector expressing short hairpin rna against panx3 (shpanx3, ggcaggcagagcaacttagtaagagattaataaggatatga) and its negative control (shnc) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The FASEB Journal
Article Title: Lysine-specific demethylase-2 is distinctively involved in brown and beige adipogenic differentiation
doi: 10.1096/fj.201801422RR
Figure Lengend Snippet: LSD2 is essential for BAT differentiation in HB2 cells. A, B) Dox-inducible KD of LSD2. HB2 cells were transduced with tet-inducible shLSD2 (LSD2-KD#1 and #2) or control (shCtr) lentiviral vectors followed by blasticidin selection. Cells were cultured with or without Dox for 48 h. For relative mRNA levels of LSD2 (A), real-time quantitative PCR values were normalized to values for the 36B4 gene and are shown as fold differences against Dox (−). For levels of LSD2 protein (B), β-tubulin was used as a loading control. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01. C) Oil Red O staining of shRNA-expressing HB2 cells at d 7. Culture details are described in Supplemental Fig. S1A. Scale bars, 100 µm. D) Expression of adipogenesis and BAT-selective genes in shLSD2_#1 cells at indicated days. Quantitative RT-PCR values were normalized to those for the 36B4 gene and are shown as fold differences against Dox (−) at d 0. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01 vs. Dox (−) at each time point.
Article Snippet: Lentiviral expression of short hairpin RNA Lentiviral vectors for tetracycline (tet)-inducible
Techniques: Transduction, Control, Selection, Cell Culture, Real-time Polymerase Chain Reaction, Staining, shRNA, Expressing, Quantitative RT-PCR