|
BioResource International Inc
lentiviral vectors for tetracycline-inducible short hairpin rna expression Lentiviral Vectors For Tetracycline Inducible Short Hairpin Rna Expression, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pmc08114557-47-10-20?v=BioResource+International+Inc Average 90 stars, based on 1 article reviews
lentiviral vectors for tetracycline-inducible short hairpin rna expression - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
BioResource International Inc
lentiviral vectors for tetracycline (tet)-inducible short hairpin rna (shrna) expression ![]() Lentiviral Vectors For Tetracycline (Tet) Inducible Short Hairpin Rna (Shrna) Expression, supplied by BioResource International Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pmc06436657-94-11-23?v=BioResource+International+Inc Average 90 stars, based on 1 article reviews
lentiviral vectors for tetracycline (tet)-inducible short hairpin rna (shrna) expression - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Cyagen Biosciences
recombinant lentiviral vectors expressing short hairpin rna (shrna) targeting fth1p3 ![]() Recombinant Lentiviral Vectors Expressing Short Hairpin Rna (Shrna) Targeting Fth1p3, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pmc06949746-101-14-24?v=Cyagen+Biosciences Average 90 stars, based on 1 article reviews
recombinant lentiviral vectors expressing short hairpin rna (shrna) targeting fth1p3 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
lentiviral vectors encoding guide rna targeting human cd74 ![]() Lentiviral Vectors Encoding Guide Rna Targeting Human Cd74, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/10__1158_slash_0008___5472__can___20___2811-98-12-14?v=GenScript+corporation Average 90 stars, based on 1 article reviews
lentiviral vectors encoding guide rna targeting human cd74 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Shanghai GenePharma
lentiviral vectors expressing a short hairpin rna against vdr ![]() Lentiviral Vectors Expressing A Short Hairpin Rna Against Vdr, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pm27561793-68-0-16?v=Shanghai+GenePharma Average 90 stars, based on 1 article reviews
lentiviral vectors expressing a short hairpin rna against vdr - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
VectorBuilder GmbH
lentiviral vector expressing short hairpin rna against panx3 (shpanx3, ggcaggcagagcaacttagtaagagattaataaggatatga) and its negative control (shnc) ![]() Lentiviral Vector Expressing Short Hairpin Rna Against Panx3 (Shpanx3, Ggcaggcagagcaacttagtaagagattaataaggatatga) And Its Negative Control (Shnc), supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/guide+rna+lentiviral+expression+vector/pm37021698-54-12-18?v=VectorBuilder+GmbH Average 90 stars, based on 1 article reviews
lentiviral vector expressing short hairpin rna against panx3 (shpanx3, ggcaggcagagcaacttagtaagagattaataaggatatga) and its negative control (shnc) - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The FASEB Journal
Article Title: Lysine-specific demethylase-2 is distinctively involved in brown and beige adipogenic differentiation
doi: 10.1096/fj.201801422RR
Figure Lengend Snippet: LSD2 is essential for BAT differentiation in HB2 cells. A, B) Dox-inducible KD of LSD2. HB2 cells were transduced with tet-inducible shLSD2 (LSD2-KD#1 and #2) or control (shCtr) lentiviral vectors followed by blasticidin selection. Cells were cultured with or without Dox for 48 h. For relative mRNA levels of LSD2 (A), real-time quantitative PCR values were normalized to values for the 36B4 gene and are shown as fold differences against Dox (−). For levels of LSD2 protein (B), β-tubulin was used as a loading control. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01. C) Oil Red O staining of shRNA-expressing HB2 cells at d 7. Culture details are described in Supplemental Fig. S1A. Scale bars, 100 µm. D) Expression of adipogenesis and BAT-selective genes in shLSD2_#1 cells at indicated days. Quantitative RT-PCR values were normalized to those for the 36B4 gene and are shown as fold differences against Dox (−) at d 0. Values are mean ± sd (n = 3). *P < 0.05, †P < 0.01 vs. Dox (−) at each time point.
Article Snippet: Lentiviral expression of short hairpin RNA Lentiviral vectors for tetracycline (tet)-inducible
Techniques: Transduction, Control, Selection, Cell Culture, Real-time Polymerase Chain Reaction, Staining, shRNA, Expressing, Quantitative RT-PCR
Journal: International Journal of Clinical and Experimental Pathology
Article Title: Long non-coding RNA FTH1P3 promotes the metastasis and aggressiveness of non-small cell lung carcinoma by inducing epithelial-mesenchymal transition
doi:
Figure Lengend Snippet: FTH1P3 is upregulated in NSCLC tumor tissues an NSCLC-derived cell lines. A. qRT-PCR analysis of FTH1P3 expression in NSCLC tumor tissues and matched normal tissues from 60 patients. GAPDH was used as an internal control, n = 3. B. Metastatic NSCLC tumors had higher FTH1P3 expression levels compared with those of nonmetastatic NSCLC tumors (n = 3). *P < 0.05 vs control. FTH1P3: ferritin heavy chain 1 pseudogene 3; NSCLC: non-small cell lung carcinoma; qRT-PCR: quantitative real-time PCR.
Article Snippet: Plasmid construction and cell transfection Recombinant lentiviral vectors expressing short hairpin RNA (shRNA) targeting
Techniques: Derivative Assay, Quantitative RT-PCR, Expressing, Control, Real-time Polymerase Chain Reaction
Journal: International Journal of Clinical and Experimental Pathology
Article Title: Long non-coding RNA FTH1P3 promotes the metastasis and aggressiveness of non-small cell lung carcinoma by inducing epithelial-mesenchymal transition
doi:
Figure Lengend Snippet: Increased expression of FTH1P3 is associated with poor prognosis in NSCLC patients. A. qRT-PCR analysis of FTH1P3 expression in three NSCLC cell lines (A549, H596, and SPCA1), human lung epithelial cell line (BEAS-2B), and human bronchial epithelial cell line (HBE). B. Kaplan-Meier survival analysis showing correlation between FTH1P3 expression levels and overall survival rate of patients with NSCLC. *P < 0.05 vs HBE or BEAS-2B, #P < 0.05 vs SPCA1.
Article Snippet: Plasmid construction and cell transfection Recombinant lentiviral vectors expressing short hairpin RNA (shRNA) targeting
Techniques: Expressing, Quantitative RT-PCR
Journal: International Journal of Clinical and Experimental Pathology
Article Title: Long non-coding RNA FTH1P3 promotes the metastasis and aggressiveness of non-small cell lung carcinoma by inducing epithelial-mesenchymal transition
doi:
Figure Lengend Snippet: Correlation between clinicopathologic features and FTH1P3 expression levels in 60 NSCLC patients
Article Snippet: Plasmid construction and cell transfection Recombinant lentiviral vectors expressing short hairpin RNA (shRNA) targeting
Techniques: Expressing
Journal: International Journal of Clinical and Experimental Pathology
Article Title: Long non-coding RNA FTH1P3 promotes the metastasis and aggressiveness of non-small cell lung carcinoma by inducing epithelial-mesenchymal transition
doi:
Figure Lengend Snippet: Knockdown of FTH1P3 inhibits cell migration of NSCLC cells. A. The expression levels of FTH1P3 were examined in A549 and H596 cells transfected with the shRNA-FTH1P3 and shRNA-NC lentiviruses (n = 3). B. Wound healing assay was used to evaluate the effect of FTH1P3 knockdown on NSCLC cell migration (n = 3). The migration distances of A549 cells were observed at 0 and 24 h after wounding. C. The migration distances of H596 cells were observed at 0 and 24 h after wounding. D. Knockdown of FTH1P3 strongly inhibited migratory capability (n = 3). ShRNA: short hairpin RNA; shRNA-NC: negative control shRNA. *P < 0.05 vs shRNA-NC lentivirus.
Article Snippet: Plasmid construction and cell transfection Recombinant lentiviral vectors expressing short hairpin RNA (shRNA) targeting
Techniques: Knockdown, Migration, Expressing, Transfection, shRNA, Wound Healing Assay, Negative Control
Journal: International Journal of Clinical and Experimental Pathology
Article Title: Long non-coding RNA FTH1P3 promotes the metastasis and aggressiveness of non-small cell lung carcinoma by inducing epithelial-mesenchymal transition
doi:
Figure Lengend Snippet: FTH1P3 inhibition suppresses invasion of NSCLC cells. A. Transwell invasion assay was used to evaluate the effect of FTH1P3 knockdown on NSCLC cell invasive capacity. Markedly reduced cell invasion in A549 cells following knockdown of FTH1P3 by shRNA-FTH1P3 (n = 3). B. Representative images of shRNA-FTH1P3 and shRNA-NC lentiviruses transfected H596 cells. Downregulation of FTH1P3 significantly suppressed the invasion ability of H596 cells (n = 3). *P < 0.05 vs shRNA-NC lentivirus.
Article Snippet: Plasmid construction and cell transfection Recombinant lentiviral vectors expressing short hairpin RNA (shRNA) targeting
Techniques: Inhibition, Transwell Invasion Assay, Knockdown, shRNA, Transfection
Journal: International Journal of Clinical and Experimental Pathology
Article Title: Long non-coding RNA FTH1P3 promotes the metastasis and aggressiveness of non-small cell lung carcinoma by inducing epithelial-mesenchymal transition
doi:
Figure Lengend Snippet: FTH1P3 facilitates NSCLC cell migration and invasion by inducing EMT. A. A549 and H596 cells were transfected with shRNA-FTH1P3 and shRNA-NC lentiviruses, and western blotting was conducted to analyze the expression of E-cadherin, N-cadherin, Snail and vimentin. B. FTH1P3 knockdown could decrease expression of N-cadherin, vimentin and Snail protein of NSCLC cells, but promote E-cadherin protein expression (n = 3). *P < 0.05 vs shRNA-NC lentivirus.
Article Snippet: Plasmid construction and cell transfection Recombinant lentiviral vectors expressing short hairpin RNA (shRNA) targeting
Techniques: Migration, Transfection, shRNA, Western Blot, Expressing, Knockdown